RegulonDB RegulonDB 10.9: Gene Sequence
fadH gene sequence


Size: 2019        A: 463  T: 401  G: 607  C: 548

Fasta

 

>fadH E. coli K12. Version NC_000913.3 GI:556503834
atgagctacccgtcgctgttcgccccgctggatttaggttttaccacgttaaaaaaccgc
gtgttgatgggctcaatgcacaccgggctggaggaatacccggacggtgccgagcggctg
gcagcgttttatgccgaacgcgcccgtcacggcgtggcgctgattgtcagcggcggcatt
gcaccagatttaacaggcgttggcatggaaggtggcgcaatgctcaacgacgccagccag
atcccacaccatcgcaccattaccgaagcggtacatcaggaaggcggcaaaatagccctg
caaattttgcataccgggcgctacagctaccaaccgcatctggtcgccccgtccgcattg
caggcccccatcaaccgtttcgtgccccatgagttaagccatgaagagatcctgcaactg
atcgacaatttcgcccgctgcgcgcaactggcgcgggaggcaggatacgacggtgtagag
gtgatgggttccgaagggtatttgatcaacgaatttctgacgctgcgcaccaatcagcgt
agtgaccagtggggcggcgattaccgcaaccggatgcgatttgccgtagaagtagtgcgt
gcggtgcgcgaacgcgtcggcaacgacttcattattatctaccgactgtcgatgctcgac
ctggtcgaagacggcgggacttttgccgaaacggtagagctggcgcaggccattgaagcg
gcgggcgcgaccattatcaacaccggcattggctggcatgaagcacgtattccgaccatt
gccacgcccgtgccgcgcggcgcatttagctgggtcacgcgcaaactgaaaggccacgtc
tcgctgccgctggtaaccaccaaccggattaacgatccgcaggttgccgacgatattctc
tcgcgcggcgatgccgatatggtatcgatggcgcgaccgtttcttgctgatgcggagctg
ctgtcaaaagcgcaatcgggacgagccgatgagatcaacacttgtattggctgcaatcag
gcctgtctcgatcaaatcttcgttggcaaagtcacctcgtgcctggtgaatcctcgcgcc
tgccacgaaaccaaaatgccaatccttcccgccgtgcagaaaaaaaatctggcggtggtc
ggtgcgggacctgctgggctggcgtttgccattaacgcggcggcgcgtgggcatcaggta
acattgtttgacgctcatagcgagattggcgggcagtttaatatcgccaaacagatcccc
ggcaaagaggagttttacgaaacgctgcgctattaccgccggatgatcgaagtgacgggc
gtgacgctaaaactcaatcacaccgtgacggcggatcagttacaggctttcgatgaaacg
atcctcgccagtgggatcgtgccgcgcactccgcccatcgacgggatcgatcatccgaag
gtattgagttatctcgatgtactgcgcgacaaagcgccggttggcaacaaagttgccatc
atcggttgtggcgggattggttttgatacggcgatgtatttaagtcagccgggcgaatcc
accagccagaatatcgccgggttctgtaatgaatgggggatcgacagtagcctacaacag
gctggtggcttaagcccgcagggaatgcagatcccccgtagcccacggcagattgtgatg
ctccagcgcaaagccagcaaaccaggacaggggttaggcaaaaccaccggctggatccat
cgcaccaccctgctctcgcggggtgtgaaaatgatcccaggcgtaagttatcagaagatt
gacgatgacgggctgcatgtggtgatcaacggcgaaacgcaggtattagcagtggacaat
gtggtgatctgcgcagggcaagagccaaaccgcgcgctggcgcaaccgctgattgatagc
gggaaaacggtgcatttaattggcggctgcgatgtggctatggagctggacgcacgacgg
gcaattgcccagggaacacggctggcgctggagatttaa
              
                            

Download fasta file
RegulonDB