RegulonDB RegulonDB 10.9: Gene Sequence
flgG gene sequence


Size: 783        A: 206  T: 156  G: 207  C: 214

Fasta

 

>flgG E. coli K12. Version NC_000913.3 GI:556503834
atgatcagttcattatggatcgccaaaacgggccttgacgcccagcaaaccaatatggac
gtcattgccaacaacctggcaaacgtcagtactaacggttttaagcgtcagcgcgcggtg
tttgaagatctgctttatcaaaccattcgccagccgggggcacagtcttccgaacaaacc
accttaccctccggattacaaatcggcacgggggtacgcccggtcgccactgaacgctta
cacagccagggaaacctgtcgcagaccaacaacagcaaagatgtcgcgattaaagggcag
ggctttttccaggtgatgttgccagatggttcatcagcctatacccgtgacggctctttc
caggtggatcagaacgggcagctggtgacggctggtggttttcaggtgcagccagcgatc
accattccggcgaatgcgttaagtatcaccatcggtcgtgatggcgtggtcagcgtaacc
caacaaggccaggcagctccggttcaggttgggcagctcaatctcaccacctttatgaat
gacaccgggctggagagcattggcgaaaacctctacaccgaaacgcaatcctctggtgca
ccgaacgaaagcacgccgggcctgaacggcgcgggactgctgtatcaagggtatgttgaa
acgtctaacgtcaacgtggcggaagaactggtcaatatgattcaggtgcaacgcgcttac
gaaatcaacagtaaagcggtgtccaccaccgatcagatgctgcaaaaactgacgcaactc
taa
              
                            

Download fasta file
RegulonDB