RegulonDB RegulonDB 10.9: Gene Sequence
flgH gene sequence


Size: 699        A: 159  T: 166  G: 187  C: 187

Fasta

 

>flgH E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaaaaacgctgcgcatacttatgccatttccagcttgttggtgctttcactaacc
ggctgcgcctggataccctccacgccgctggtgcagggggcgaccagtgcacaaccggtt
cccggtccgacgcccgtcgccaacggttctattttccagtctgctcagccgattaactat
ggctatcaaccgctgtttgaagatcgtcgaccacgcaatattggcgatacgctgaccatc
gtgttgcaggagaacgtcagcgccagcaaaagctcctctgcgaatgccagccgtgacggt
aaaactaattttggctttgatactgtgccgcgctatttgcaggggctgtttggtaacgct
cgtgccgatgtcgaagcctccggtggtaacacgttcaacggaaagggcggggccaatgcc
agcaatacctttagcggcacgttgacggtgacggttgaccaggtactggtcaacggcaac
ctgcatgtggtgggtgaaaaacagattgccattaatcagggtaccgaatttattcgcttc
tctggcgtggttaatccacgcactatcagcggcagcaataccgtaccgtctactcaggtg
gcggatgcgcgcattgaatacgtaggcaatggctacattaacgaagcgcaaaatatgggc
tggttgcagcgtttcttccttaacctgtcgccaatgtaa
              
                            

Download fasta file
RegulonDB