RegulonDB RegulonDB 10.10: Gene Sequence
flgJ gene sequence


Size: 942        A: 256  T: 171  G: 265  C: 250

Fasta

 

>flgJ E. coli K12. Version NC_000913.3 GI:556503834
atgatcagcgacagcaaactactggcaagtgcggcctgggatgcgcaatcactcaacgaa
ctaaaggcgaaagcgggcgaagatccggcggcaaatatccgtccggtggcccgtcaggtg
gaagggatgttcgtgcagatgatgttgaaaagcatgcgcgacgctttaccaaaagatggc
ctgttcagcagcgagcacactcgcctgtataccagtatgtatgaccagcagattgcccaa
cagatgacggcgggcaaaggtctggggcttgcagagatgatggttaaacagatgacgcca
gaacaaccattgccagaggagtccacgccagcagcaccgatgaaattcccgctcgaaact
gtggtgcgttatcaaaatcaggcgctttcgcagctggtgcaaaaggccgtgccacgtaac
tacgatgattcgctgccgggtgacagtaaagcattcctcgcgcaactctcgctgcccgcc
caactggcaagccagcaaagcggtgtgccacatcatttgatcctcgctcaggcggcactg
gaatctggttgggggcaacggcaaatccgccgcgaaaacggcgagccgagctataacctg
tttggtgtcaaagcctctggcaactggaaagggccagttactgaaatcaccacgactgaa
tatgaaaacggcgaagcgaagaaagtaaaagcgaagtttcgcgtctacagctcgtatctg
gaagccttgtcggattacgttgggctgttaacgcgtaacccgcgctacgccgccgtgacg
accgccgcgagtgcggaacagggggcgcaggccctacaggacgcgggctatgccaccgat
cctcactatgcccgcaaactcaccaacatgattcagcagatgaaatcgataagcgacaag
gtgagcaaaacctacagtatgaacattgataatctgttctga
              
                            

Download fasta file
RegulonDB