RegulonDB RegulonDB 10.8: Gene Sequence
flhA gene sequence


Size: 2079        A: 439  T: 499  G: 623  C: 518

Fasta

 

>flhA E. coli K12. Version NC_000913.3 GI:556503834
atgagtaatctggccgcgatgctgcgcctgcccgcaaacctgaaatcgacacaatggcag
atccttgccggaccgattttgatcctgttgatcttgtcgatgatggtgctgccactgccc
gcattcatactcgacctgttgtttaccttcaatattgccttgtcgatcatggtgttgctg
gtggcgatgtttacccagcgcacgcttgagtttgctgcgtttccgaccattctgttgttt
accacgctgttgcgtctggcacttaacgtggcttcaacccgtatcattttaatggaaggg
cataccggcgcggcggcggcagggaaggtggtcgaagcgttcggtcacttcctcgttggt
ggcaatttcgctatcggtatcgtggtgtttgtcattctcgtgatcatcaactttatggtc
attaccaaaggtgccgggcgtatcgcagaagtgggtgcgcgctttgttctcgatggtatg
ccgggtaagcagatggcgattgacgccgaccttaacgccggattgattggtgaagatgag
gcgaaaaaacgccgctccgaagtgactcaggaagccgatttttacggctcaatggacggg
gcaagtaagtttgttcgcggcgatgccatcgccgggatcctcatcatggtcattaacatt
gtcggcgggttgctggtcggcgtgctgcaacatggcatgagcatgggacacgcggcggaa
agttatacgctattgaccattggcgacggtctggtggcacaaattccggcgctggtgatt
tctaccgccgcgggggtcatcgttacgcgtgtcagcaccgatcaggatgttggcgagcag
atggtgaatcagcttttcagtaacccaagcgttatgttgttaagcgccgccgtgctcggt
ttactcggcctggtgcctggaatgccgaacctggtatttttgctgttcactgccggattg
ctcgggctggcctggtggatacgcggacgcgaacaaaaagcgcctgccgaacccaaaccg
gtaaaaatggcagagaataataccgttgtcgaagcgacgtggaacgatgtacaactggaa
gattctctgggaatggaagtgggttatcgactgatcccgatggtcgatttccagcaggat
ggtgagttgttgggccgtatacgcagtatccgcaagaaatttgcccaggagatgggattt
ctgccgccagtggtgcacattcgcgacaatatggatctgcaacctgcccgctatcgcatt
ttgatgaaaggcgtggagattggcagtggtgatgcttatccggggcgctggctggcgatt
aaccctggaaccgctgccgggacgttacctggtgaggcgaccgtcgatccggcatttggc
ctgaatgctatctggattgaaagtgcgctaaaagaacaggcgcagattcaggggtacaca
gtggttgaggccagcacggtggtagcaacgcatcttaaccacctcattagccagcatgcc
gcagagctgtttggtcgtcaggaggcgcaacagctgttggatcgcgtcgcccaggagatg
ccaaagctgacggaagatctcgttcctggcgtcgtcacgctcaccacactgcataaagtg
ctgcaaaatctcctcgatgaaaaagtaccgattcgcgatatgcgcaccattctcgaaacg
ctggcggaacatgcgcccatccaaagcgatccacatgaattaaccgccgtcgtgcgcgtg
gcgttgggacgggcgattacccagcagtggtttcctggcaaagatgaagtccatgttatt
ggcctcgatacaccgctggaacgtttgttactacaggcgctgcagggcgggggaggactg
gagccagggctggcggatcgtttactggcgcaaactcaggaagcgctatcccgtcaggag
atgctgggtgcgccgccagtattgttggtgaaccacgcgctgcgaccattattgtctcgc
ttcctgcgccgcagcttgccgcagttagtggtcctgtcgaatctggaactgtctgataac
cgacatatccgcatgacggcgacaattggcggcaaataa
              
                            

Download fasta file
RegulonDB