RegulonDB RegulonDB 10.9: Gene Sequence
yaeP gene sequence


Size: 201        A: 55  T: 44  G: 62  C: 40

Fasta

 

>yaeP E. coli K12. Version NC_000913.3 GI:556503834
gtggaaaaatattgtgagttaatacgcaagcggtacgcggaaatcgccagcggagactta
ggatacgttccggacgcgctgggctgcgttttgaaagtgctgaatgaaatggctgccgac
gacgccctttctgaggctgtcagggaaaaagcagcatacgctgcggcaaacttactggtg
agcgattatgtcaatgaatga
              
                            

Download fasta file
RegulonDB