RegulonDB RegulonDB 10.9: Gene Sequence
fliJ gene sequence


Size: 444        A: 140  T: 75  G: 122  C: 107

Fasta

 

>fliJ E. coli K12. Version NC_000913.3 GI:556503834
atggcagaacatggtgcgctggcgaccctgaaagatctggcagaaaaagaggtagaggat
gccgcgcgcctgctgggtgaaatgcgtcgcggatgtcagcaggcggaagaacagctcaaa
atgctgattgattatcagaatgaatatcgcaataacctcaacagcgatatgagtgccggg
ataaccagcaaccgctggatcaactatcagcagtttatccagacgctggaaaaagccatt
actcagcatcgccagcaacttaatcagtggacgcagaaagttgacattgccctgaacagt
tggcgagaaaaaaaacaacgtttgcaggcctggcagacactgcaggaacggcaatccacg
gcggcactgcttgcagaaaaccgcctcgatcagaaaaagatggatgagttcgcccagcgc
gccgccatgaggaaacctgaatga
              
                            

Download fasta file
RegulonDB