RegulonDB RegulonDB 10.9: Gene Sequence
fliK gene sequence


Size: 1128        A: 304  T: 205  G: 278  C: 341

Fasta

 

>fliK E. coli K12. Version NC_000913.3 GI:556503834
atgattcgcttagcgcccttgattaccgccgacgttgacaccaccacattgcctggcggc
aaagccagcgatgctgcacaagattttctcgcgttgttgagcgaagcattagcaggcgag
acaactaccgacaaagcggccccccagttgctggtggcaacagataagcccacgacaaaa
ggcgagccgctgatcagcgatattgtttccgacgcgcaacaagctaatttactgatccct
gtggatgaaacaccgcctgtcatcaacgacgaacaatccacatcaacaccgttaaccacc
gctcagacgatggcgttggctgcggtggctgacaaaaatacgacaaaagacgaaaaagcg
gatgatctgaatgaagacgtcaccgcaagcctgagcgccctttttgcgatgttgccgggt
tttgacaatacgcccaaagtgactgatgcgccgtcaaccgtgttaccgacagagaaacca
acgctcttcacaaaactgacttctgagcaactcacaacagcacagcctgatgacgccccc
ggcacaccagctcagccattaacaccgctggtagcagaagcccagagtaaagcggaagtc
atcagcacaccttcaccggtgaccgctgccgccagcccgctaatcactccacaccagaca
cagccactgcccaccgtcgccgcacctgttttgagtgcaccgctgggttctcacgaatgg
caacaatcattaagccagcatatttcgctgttcacccgccaggggcaacaaagtgcagag
ttgcgtctgcacccgcaggatttaggtgaagtgcaaatctccctcaaagtggatgataac
caggcgcaaatccagatggtttcaccgcatcagcatgtacgcgccgccctggaagcagcg
ctgccggtactgcgcacgcagctggccgaaagtggcattcagttagggcaaagcaacatc
agtggcgaaagctttagtggtcagcagcaggccgcttcccagcaacagcaaagccaacgc
acagcaaaccatgaacctctggcgggggaagacgacgatacgcttccggttcccgtctct
ttacaagggcgtgtaacaggcaacagcggcgttgatattttcgcctaa
              
                            

Download fasta file
RegulonDB