RegulonDB RegulonDB 10.9: Gene Sequence
nanT gene sequence


Size: 1491        A: 272  T: 398  G: 432  C: 389

Fasta

 

>nanT E. coli K12. Version NC_000913.3 GI:556503834
atgagtactacaacccagaatatcccgtggtatcgccatctcaaccgtgcacaatggcgc
gcattttccgctgcctggttgggatatctgcttgacggttttgatttcgttttaatcgcc
ctggtactcaccgaagtacaaggtgaattcgggctgacgacggtgcaggcggcaagtctg
atctctgcagcctttatctctcgctggttcggcggcctgatgctcggcgctatgggtgac
cgctacgggcgtcgtctggcaatggtcaccagcatcgttctcttctcggccgggacgctg
gcctgcggctttgcgccaggctacatcaccatgtttatcgctcgtctggtcatcggcatg
gggatggcgggtgaatacggttccagcgccacctatgtcattgaaagctggccaaaacat
ctgcgtaacaaagccagtggttttttgatttcaggcttctctgtgggggccgtcgttgcc
gctcaggtctatagcctggtggttccggtctggggctggcgtgcgctgttctttatcggc
attttgccaatcatctttgctctctggctgcgtaaaaacatcccggaagcggaagactgg
aaagagaaacacgcaggtaaagcaccagtacgcacaatggtggatattctctaccgtggt
gaacatcgcattgccaatatcgtaatgacactggcggcggctactgcgctgtggttctgc
ttcgccggtaacctgcaaaatgccgcgatcgtcgctgttcttgggctgttatgcgccgca
atctttatcagctttatggtgcagagtgcaggcaaacgctggccaacgggcgtaatgctg
atggtggtcgtgttgtttgctttcctctactcatggccgattcaggcgctgctgccaacg
tatctgaaaaccgatctggcttataacccgcatactgtagccaatgtgctgttctttagt
ggctttggcgcggcggtgggatgctgcgtaggtggcttcctcggtgactggctgggaacc
cgcaaagcgtacgtttgtagcctgctggcctcgcagctgctgattattccggtatttgcg
attggcggcgcaaacgtctgggtgctcggtctgttactgttcttccagcaaatgcttgga
caagggatcgccgggatcttaccaaaactgattggcggttatttcgataccgaccagcgt
gcagcgggcctgggctttacctacaacgttggcgcattgggcggtgcactggccccaatc
atcggcgcgttgatcgctcaacgtctggatctgggtactgcgctggcatcgctctcgttc
agtctgacgttcgtggtgatcctgctgattgggctggatatgccttctcgcgttcagcgt
tggttgcgcccggaagcgttgcgtactcatgacgctatcgacggtaaaccattcagcggt
gccgtgccgtttggcagcgccaaaaacgatttagtcaaaaccaaaagttaa
              
                            

Download fasta file
RegulonDB