RegulonDB RegulonDB 10.9: Gene Sequence
ldhA gene sequence


Size: 990        A: 256  T: 238  G: 257  C: 239

Fasta

 

>ldhA E. coli K12. Version NC_000913.3 GI:556503834
atgaaactcgccgtttatagcacaaaacagtacgacaagaagtacctgcaacaggtgaac
gagtcctttggctttgagctggaattttttgactttctgctgacggaaaaaaccgctaaa
actgccaatggctgcgaagcggtatgtattttcgtaaacgatgacggcagccgcccggtg
ctggaagagctgaaaaagcacggcgttaaatatatcgccctgcgctgtgccggtttcaat
aacgtcgaccttgacgcggcaaaagaactggggctgaaagtagtccgtgttccagcctat
gatccagaggccgttgctgaacacgccatcggtatgatgatgacgctgaaccgccgtatt
caccgcgcgtatcagcgtacccgtgatgctaacttctctctggaaggtctgaccggcttt
actatgtatggcaaaacggcaggcgttatcggtaccggtaaaatcggtgtggcgatgctg
cgcattctgaaaggttttggtatgcgtctgctggcgttcgatccgtatccaagtgcagcg
gcgctggaactcggtgtggagtatgtcgatctgccaaccctgttctctgaatcagacgtt
atctctctgcactgcccgctgacaccggaaaactatcatctgttgaacgaagccgccttc
gaacagatgaaaaatggcgtgatgatcgtcaataccagtcgcggtgcattgattgattct
caggcagcaattgaagcgctgaaaaatcagaaaattggttcgttgggtatggacgtgtat
gagaacgaacgcgatctattctttgaagataaatccaacgacgtgatccaggatgacgta
ttccgtcgcctgtctgcctgccacaacgtgctgtttaccgggcaccaggcattcctgaca
gcagaagctctgaccagtatttctcagactacgctgcaaaacttaagcaatctggaaaaa
ggcgaaacctgcccgaacgaactggtttaa
              
                            

Download fasta file
RegulonDB