RegulonDB RegulonDB 10.9: Gene Sequence
yaaX gene sequence


Size: 297        A: 77  T: 60  G: 77  C: 83

Fasta

 

>yaaX E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaaagatgcaatctatcgtactcgcactttccctggttctggtcgctcccatggca
gcacaggctgcggaaattacgttagtcccgtcagtaaaattacagataggcgatcgtgat
aatcgtggctattactgggatggaggtcactggcgcgaccacggctggtggaaacaacat
tatgaatggcgaggcaatcgctggcacctacacggaccgccgccaccgccgcgccaccat
aagaaagctcctcatgatcatcacggcggtcatggtccaggcaaacatcaccgctaa
              
                            

Download fasta file
RegulonDB