RegulonDB RegulonDB 10.9: Gene Sequence
yaaW gene sequence


Size: 714        A: 187  T: 164  G: 198  C: 165

Fasta

 

>yaaW E. coli K12. Version NC_000913.3 GI:556503834
atgaatgttaattacctgaatgattcagatctggattttcttcagcattgtagtgaggaa
cagttggcaaatttcgcccgattgctcacccataatgaaaaaggcaaaactcgcctctcc
agcgtactgatgcgcaacgaactgtttaaatcgatggaagggcatcccgagcaacatcgc
cgcaactggcagctgattgccggagaattacagcattttggtggcgatagtatcgccaac
aaactgcgcggacacggtaaattgtatcgggccattttgctcgatgtttcaaagcgattg
aagctgaaagccgacaaagagatgtctacgtttgaaattgagcaacagttactggaacaa
tttctgcgtaatacctggaagaaaatggacgaggaacataagcaggagtttctgcacgcg
gtcgatgccagggtgaatgagctggaagagctgctgccgctgctgatgaaagacaaatta
ttggcaaaaggtgtgtcgcatttgctttccagccaactgacccgcattttacgcacccac
gcagcaatgagcgtacttgggcatggtttgctgcgcggcgcggggctgggaggccctgta
ggtgcggcactaaatggggttaaagcggtcagcggcagcgcctatcgcgtgacgattcca
gccgtactgcaaatcgcctgcctgcgccggatggttagcgccactcaggtctga
              
                            

Download fasta file
RegulonDB