RegulonDB RegulonDB 10.9: Gene Sequence
insL1 gene sequence


Size: 1113        A: 275  T: 260  G: 304  C: 274

Fasta

 

>insL-1 E. coli K12. Version NC_000913.3 GI:556503834
atgaattactctcacgataactggtcagcaattctggcccatattggtaagcccgaagaa
ctggatacttcggcacgtaatgccggggctctaacccgccgccgcgaaattcgtgatgct
gcaactctgctacgtctggggctggcttacggccccggggggatgtcattacgtgaagtc
actgcatgggctcagctccatgacgttgcaacattatctgacgtggctctcctgaagcgg
ctgcggaatgccgccgactggtttggcatacttgccgcacaaacacttgctgtacgcgcc
gcagttacgggttgtacaagcggaaagagattgcgtcttgtcgatggaacagcaatcagt
gcgcccgggggcggcagcgctgaatggcgactacatatgggatatgatcctcatacctgt
cagttcactgattttgagctaaccgacagcagagacgctgaacggctggaccgatttgcg
caaacggcagacgagatacgcattgctgaccggggattcggttcgcgtcccgaatgtatc
cgctcacttgcttttggagaagctgattatatcgtccgggttcactggcgaggattgcgc
tggttaactgcagaaggaatgcgctttgacatgatgggttttctgcgcgggctggattgc
ggtaagaacggtgaaaccactgtaatgataggcaattcaggtaataaaaaagccggagct
ccctttccggcacgtctcattgccgtatcacttcctcccgaaaaagcattaatcagtaaa
acccgactgctcagcgagaatcgtcgaaaaggacgagtagttcaggcggaaacgctggaa
gcagcgggccatgtgctattgctaacatcattaccggaagatgaatattcagcagagcaa
gtggctgattgttaccgtctgcgatggcaaattgaactggcttttaagcggctcaaaagt
ttgctgcacctggatgctttgcgtgcaaaggaacctgaactcgcgaaagcgtggatattt
gctaatctactcgccgcatttttaattgacgacataatccagccatcgctggatttcccc
cccagaagtgccggatccgaaaagaagaactaa
              
                            

Download fasta file
RegulonDB