RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 309        A: 74  T: 74  G: 70  C: 91

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
gtgccggaaagggagctccggcttttttattacctgaattgcctatcattacagtggttt
caccgttcttaccgcaatccagcccgcgcagaaaacccatcatgtcaaagcgcattcctt
ctgcagttaaccagcgcaatcctcgccagtgaacccggacgatataatcagcttctccaa
aagcaagtgagcggatacattcgggacgcgaaccgaatccccggtcagcaatgcgtatct
cgtctgccgtttgcgcaaatcggtccagccgttcagcgtctctgctgtcggttagctcaa
aatcagtga
              
                            

Download fasta file
RegulonDB