RegulonDB RegulonDB 10.9: Gene Sequence
yaaY gene sequence


Size: 219        A: 47  T: 65  G: 55  C: 52

Fasta

 

>yaaY E. coli K12. Version NC_000913.3 GI:556503834
atgtgccggcactcgttacgtagtgatggcgcaggattctaccagcttgcggggtgtgaa
tacagcttttccgcgataaaaattgcagcaggcggtcagtttcttcccgtgatttgcgcc
atggcaatgaaaagccacttctttctgatttcggtactcaatcgccggttaaccttgacc
gctgtacaaggtatactcggacgattttcactgttttga
              
                            

Download fasta file
RegulonDB