RegulonDB RegulonDB 10.9: Gene Sequence
caiF gene sequence


Size: 396        A: 118  T: 96  G: 108  C: 74

Fasta

 

>caiF E. coli K12. Version NC_000913.3 GI:556503834
atgtgtgaaggatatgttgaaaaaccactctacttgttaatcgccgaatggatgatggct
gaaaatcggtgggtgatagcaagagagatctctattcatttcgatattgaacacagcaag
gcggttaataccctgacttatattctgtcggaagtcacagaaataagctgcgaagttaag
atgatccctaataagctggaagggcggggatgccagtgtcagcgactggttaaagtggtc
gatatcgatgagcaaatttacgcgcgcctgcgcaataacagtcgggaaaaattagtcggt
gtaagaaagacgccgcgtattcctgccgttccgctcacggaacttaaccgcgagcagaag
tggcagatgatgttgtcaaagagtatgcgtcgttaa
              
                            

Download fasta file
RegulonDB