RegulonDB RegulonDB 10.10: Gene Sequence
b0100 gene sequence


Size: 135        A: 34  T: 27  G: 43  C: 31

Fasta

 

>b0100 E. coli K12. Version NC_000913.3 GI:556503834
gtggcgatctttccgaaagcgatgactggagcgaagaaccaaagcagtgacatttgtctg
atgccgcacgtaggcctgataagacgcggacagcgtcgcatcaggcatcttgtgcaaatg
tcggatgcggcgtga
              
                            

Download fasta file
RegulonDB