RegulonDB RegulonDB 10.10: Gene Sequence
ispU gene sequence


Size: 762        A: 197  T: 184  G: 215  C: 166

Fasta

 

>uppS E. coli K12. Version NC_000913.3 GI:556503834
gtgatgttgtctgctactcaaccacttagcgaaaaattgccagcgcatggctgccgtcat
gttgcgatcattatggacggcaatggccgctgggcaaaaaagcaagggaagattcgtgcc
tttgggcataaagccggggcaaaatccgtccgccgggctgtctcttttgcggccaacaac
ggtattgaggcgttaacgctgtatgcctttagtagtgaaaactggaaccgaccagcgcag
gaagtcagtgcgttaatggaactgtttgtgtgggcgctcgatagcgaagtaaaaagtctg
caccgacataacgtgcgtctgcgtattattggcgataccagtcgctttaactcgcgtttg
caagaacgtattcgtaaatctgaagcgctaacagccgggaataccggtctgacgctgaat
attgcggcgaactacggtggacgttgggatatagtccagggagtcaggcaactggctgaa
aaggtgcagcaaggaaacctgcaaccagatcagatagatgaagagatgctaaaccagcat
gtctgtatgcatgaactggcccctgtagatttagtaattaggactgggggggagcatcgc
attagtaactttttgctttggcaaattgcctatgccgaactttactttacagatgttctc
tggcccgatttcgatgaacaagactttgaaggggcgttaaatgcctttgctaatcgagag
cgtcgtttcggcggcaccgagcccggtgatgaaacagcctga
              
                            

Download fasta file
RegulonDB