RegulonDB RegulonDB 10.9: Gene Sequence
yaeR gene sequence


Size: 390        A: 92  T: 101  G: 104  C: 93

Fasta

 

>yaeR E. coli K12. Version NC_000913.3 GI:556503834
atgctgggtttaaaacaggttcaccatattgcgattattgcgacggattatgcggtgagc
aaagctttctactgcgatattcttggtttcacgctgcaaagcgaagtctatcgcgaagcg
cgcgactcatggaaaggggatttggcgcttaatgggcaatatgtgattgagcttttctca
tttccgttcccgccggaacgacccagccgaccggaagcttgcggtctgcgtcatctggct
tttagcgttgatgacatcgatgcggcagtggcgcaccttgaaagccataacgtgaagtgt
gaaaccatccgtgtcgatccatacacgcaaaaacgcttcaccttctttaacgatccggac
gggctgccgttggaactgtatgagcagtaa
              
                            

Download fasta file
RegulonDB