RegulonDB RegulonDB 10.9: Gene Sequence
tilS gene sequence


Size: 1299        A: 265  T: 280  G: 417  C: 337

Fasta

 

>tilS E. coli K12. Version NC_000913.3 GI:556503834
atgacactcacgctcaatagacaacttctcacctcacgccagattctggtggcctttagc
ggcgggcttgactccaccgttctgctgcatcagttggtgcagtggcggacggaaaatccg
ggtgtcgctctgcgcgctattcatgtgcatcacggtttaagtgccaatgccgatgcctgg
gttacgcattgcgaaaacgtctgccaacagtggcaggtgccgctggtggtcgaacgcgta
caacttgcgcaagaaggactgggcattgaggcccaggcgcggcaggcacgttatcaggca
tttgcccgcaccttgttgcccggtgaagtgctggtcaccgcgcaacatctcgacgatcaa
tgtgaaacctttctgctggcgctaaaacgcggcagtggccctgccgggctttcggctatg
gcggaagtctcggagtttgccggaacgcggcttattcgcccgttgctcgcccgcacgcgg
ggggaactggtgcagtgggcgcgtcagtatgatttacgctggattgaagacgaaagtaat
caggacgactcatacgatcgtaactttctgcgcctgcgcgtagtgccgttattgcagcag
cgttggccgcattttgccgaagcaacggcccgcagcgccgcactttgtgctgaacaagag
agcctgctggatgaactgctggcagatgatttagcacactgtcaatcgccgcaggggacg
ctgcagattgtgccaatgctggcgatgagtgatgcccgccgcgcggcgattatccgccgc
tggctggcagggcagaatgcaccgatgccttcccgcgacgcgttggtgaggatctggcag
gaagtggcgctggcgcgggaagatgcctcaccctgtttacgtttgggcgcgtttgaaatc
cgacgctatcagtcgcaactgtggtggattaaatccgtcaccgggcaaagcgaaaacatt
gtgccgtggcagacgtggcttcaaccgctggaattaccggcggggctgggaagtgtacag
cttaatgcgggaggcgatattcgccctccgcgtgcagacgaagcggtcagcgtgcgtttc
aaagcgccaggattgctgcatattgtcgggcgtaacggcggacgtaagctaaagaaaatc
tggcaagagctgggcgtgccgccgtggctacgtgacaccacgccactgctgttttatggc
gaaacgctgattgcggcggcaggggtatttgtgacgcaagaaggtgtggctgaaggtgag
aatggcgtaagttttgtctggcagaaaacgcttagttaa
              
                            

Download fasta file
RegulonDB