RegulonDB RegulonDB 10.9: Gene Sequence
rof gene sequence


Size: 255        A: 74  T: 59  G: 65  C: 57

Fasta

 

>rof E. coli K12. Version NC_000913.3 GI:556503834
atgaatgatacgtatcaaccaatcaattgtgatgattacgataatcttgagctcgcctgc
cagcatcatttaatgctgacacttgagctgaaagatggcgaaaaattgcaggcaaaagcc
agtgatttagtctcccgcaaaaatgtggagtacctggtcgtcgaggccgctggcgaaacc
cgcgagctgcgtctggataaaattaccagctttagccacccggaaatcggtacggtggtg
gtaagcgaatcctga
              
                            

Download fasta file
RegulonDB