RegulonDB RegulonDB 10.9: Gene Sequence
yaeQ gene sequence


Size: 546        A: 131  T: 129  G: 159  C: 127

Fasta

 

>yaeQ E. coli K12. Version NC_000913.3 GI:556503834
atggcgcttaaagcgacaatttataaagcgacggttaatgtggccgatctcgaccgcaac
cagtttctcgatgcctctctgacgctggcgcgccatccttcagaaacccaggagcgtatg
atgctgcgcttgctggcgtggctgaaatatgctgatgaacgtctgcaatttacccgtggt
ttgtgtgccgatgatgagccggaagcgtggctgcgtaacgatcacctgggcattgatttg
tggattgagctggggctgccggatgagcggcggattaagaaagcctgcacccaggccgca
gaagtggcgctgtttacctataatagtcgggcggcgcaaatctggtggcagcaaaatcag
agcaaatgtgtgcagtttgccaatctttccgtctggtatctggacgatgaacaactggcg
aaagtaagcgcctttgccgatcgtaccatgacgctgcaggcaacgattcaggatggcgtg
atctggttatcggatgataagaataatctggaagtgaacttaaccgcctggcaacaacct
tcatga
              
                            

Download fasta file
RegulonDB