RegulonDB RegulonDB 10.9: Gene Sequence
fadE gene sequence


Size: 2445        A: 520  T: 534  G: 735  C: 656

Fasta

 

>fadE E. coli K12. Version NC_000913.3 GI:556503834
atgatgattttgagtattctcgctacggttgtcctgctcggcgcgttgttctatcaccgc
gtgagcttatttatcagcagtctgattttgctcgcctggacagccgccctcggcgttgct
ggtctgtggtcggcgtgggtactggtgcctctggccattatcctcgtgccatttaacttt
gcgcctatgcgtaagtcgatgatttccgcgccggtatttcgcggtttccgtaaggtgatg
ccgccgatgtcgcgcactgagaaagaagcgattgatgcgggcaccacctggtgggagggc
gacttgttccagggcaagccggactggaaaaagctgcataactatccgcagccgcgcctg
accgccgaagagcaagcgtttctcgacggcccggtagaagaagcctgccggatggcgaat
gatttccagatcacccatgagctggcggatctgccgccggagttgtgggcgtaccttaaa
gagcatcgtttcttcgcgatgatcatcaaaaaagagtacggcgggctggagttctcggct
tatgcccagtctcgcgtgctgcaaaaactctccggcgtgagcgggatcctggcgattacc
gtcggcgtgccaaactcattaggcccgggcgaactgttgcaacattacggcactgacgag
cagaaagatcactatctgccgcgtctggcgcgtggtcaggagatcccctgctttgcactg
accagcccggaagcgggttccgatgcgggcgcgattccggacaccgggattgtctgcatg
ggcgaatggcagggccagcaggtgctggggatgcgtctgacctggaacaaacgctacatt
acgctggcaccgattgcgaccgtgcttgggctggcgtttaaactctccgacccggaaaaa
ttactcggcggtgcagaagatttaggcattacctgtgcgctgatcccaaccaccacgccg
ggcgtggaaattggtcgtcgccacttcccgctgaacgtaccgttccagaacggaccgacg
cgcggtaaagatgtcttcgtgccgatcgattacatcatcggcgggccgaaaatggccggg
caaggctggcggatgctggtggagtgcctctcggtaggccgcggcatcaccctgccttcc
aactcaaccggcggcgtgaaatcggtagcgctggcaaccggcgcgtatgctcacattcgc
cgtcagttcaaaatctctattggtaagatggaagggattgaagagccgctggcgcgtatt
gccggtaatgcctacgtgatggatgctgcggcatcgctgattacctacggcattatgctc
ggcgaaaaacctgccgtgctgtcggctatcgttaagtatcactgtacccaccgcgggcag
cagtcgattattgatgcgatggatattaccggcggtaaaggcattatgctcgggcaaagc
aacttcctggcgcgtgcttaccagggcgcaccgattgccatcaccgttgaaggggctaac
attctgacccgcagcatgatgatcttcggacaaggagcgattcgttgccatccgtacgtg
ctggaagagatggaagcggcgaagaacaatgacgtcaacgcgttcgataaactgttgttc
aaacatatcggtcacgtcggtagcaacaaagttcgcagcttctggctgggcctgacgcgc
ggtttaaccagcagcacgccaaccggcgatgccactaaacgctactatcagcacctgaac
cgcctgagcgccaacctcgccctgctttctgatgtctcgatggcagtgctgggcggcagc
ctgaaacgtcgcgagcgcatctcggcccgtctgggggatattttaagccagctctacctc
gcctctgccgtgctgaagcgttatgacgacgaaggccgtaatgaagccgacctgccgctg
gtgcactggggcgtacaagatgcgctgtatcaggctgaacaggcgatggatgatttactg
caaaacttcccgaaccgcgtggttgccgggctgctgaatgtggtgatcttcccgaccgga
cgtcattatctggcaccttctgacaagctggatcataaagtggcgaagattttacaagtg
ccgaacgccacccgttcccgcattggtcgcggtcagtacctgacgccgagcgagcataat
ccggttggcttgctggaagaggcgctggtggatgtgattgccgccgacccaattcatcag
cggatctgtaaagagctgggtaaaaacctgccgtttacccgtctggatgaactggcgcac
aacgcgctggtgaaggggctgattgataaagatgaagccgctattctggtgaaagctgaa
gaaagccgtctgcgcagtattaacgttgatgactttgatccggaagagctggcgacgaag
ccggtaaagttgccggagaaagtgcggaaagttgaagccgcgtaa
              
                            

Download fasta file
RegulonDB