RegulonDB RegulonDB 10.8: Gene Sequence
gmhA gene sequence


Size: 579        A: 145  T: 139  G: 156  C: 139

Fasta

 

>gmhA E. coli K12. Version NC_000913.3 GI:556503834
atgtaccaggatcttattcgtaacgaactgaacgaagcggcggaaacgctggctaacttt
ttaaaagatgacgccaatattcacgccattcagcgcgcggcggtcctgttagcagacagc
tttaaagccggtggcaaagtgctttcctgcggcaacggcggttcccattgcgacgctatg
cactttgccgaagagttgaccggtcgctaccgtgaaaaccgtccgggctacccggcgatt
gctatttctgacgttagtcatatttcctgcgtcggtaatgatttcggtttcaatgatatt
ttctcccgctacgttgaagcggtaggtcgcgaaggcgatgtactgctggggatctccacc
tccggtaactctgcaaacgtgatcaaagcgatcgcagcggcgcgtgagaagggaatgaaa
gtgatcaccctgaccggtaaagacggcggcaaaatggctggcacggcggatatcgaaatt
cgcgtaccgcactttggttatgccgaccgcattcaggagattcacattaaagtgatccat
atcctgatccagttgattgaaaaagagatggttaagtaa
              
                            

Download fasta file
RegulonDB