RegulonDB RegulonDB 10.8: Gene Sequence
yafJ gene sequence


Size: 768        A: 185  T: 171  G: 211  C: 201

Fasta

 

>yafJ E. coli K12. Version NC_000913.3 GI:556503834
atgtgcgaattgctcgggatgagcgccaacgtccctaccgatatctgctttagtttcacc
gggcttgtacagcgtggtggtggaaccgggccacataaagatggctggggcattaccttt
tacgaaggtaaaggctgtcgcacatttaaagatccacaacccagctttaattcccccatc
gccaaacttgtccaggactacccgataaaatcctgttcggtggtggctcatattcgccag
gctaatcggggcgaggtggcgctggaaaatactcacccatttacccgcgagttatggggg
cgtaactggacttatgcccataacggacaactgacgggctacaaatcactggaaaccggc
aacttccgcccggtaggcgaaaccgacagcgaaaaagccttctgctggctcctgcataaa
ttaacgcagcgttacccgcgcacaccgggcaacatggcggcggtatttaaatatatcgcc
tcactggcggatgaactgcggcagaagggcgttttcaacatgctgctttcggacgggcgc
tatgtaatggcgtattgctcgactaatttacactggatcacccgccgcgcgccgtttggc
gtggcaacgttgctggatcaggatgtggaaatcgacttcagctcgcagaccacaccgaat
gatgtggtcacggtgattgcaacacagccgctgacgggcaatgaaacctggcaaaagatt
atgccaggcgaatggcgcttattttgcctcggggagcgtgtagtttga
              
                            

Download fasta file
RegulonDB