RegulonDB RegulonDB 10.9: Gene Sequence
yafQ gene sequence


Size: 279        A: 91  T: 78  G: 56  C: 54

Fasta

 

>yafQ E. coli K12. Version NC_000913.3 GI:556503834
atgattcaaagggatattgaatactcgggacaatattcaaaggatgtaaaacttgcacaa
aagcgtcataaggatatgaataaattgaaatatcttatgacgcttcttatcaataatact
ttaccgcttccagctgtttataaagaccacccgctgcaaggttcatggaaaggttatcgc
gatgctcatgtcgaaccggactggatcctgatttacaaacttaccgataaacttttacga
tttgagagaactggaactcacgcggcgctctttgggtaa
              
                            

Download fasta file
RegulonDB