RegulonDB RegulonDB 11.1: Gene Sequence
dinJ gene sequence


Size: 261        A: 76  T: 63  G: 64  C: 58

Fasta

 

>dinJ E. coli K12. Version NC_000913.3 GI:556503834
atggctgctaacgcgtttgttcgcgcccgaatcgatgaagatctgaagaatcaggcagcg
gacgtactggccgggatggggctgaccatctctgacctggttcgcataaccctcacaaag
gtcgcgcgtgaaaaggcattgccgtttgatttacgcgagcctaatcaattaaccattcaa
tcaatcaaaaacagcgaagctggcattgatgttcataaggccaaagacgccgatgattta
tttgataaattaggaatttaa
              
                            

Download fasta file
RegulonDB