RegulonDB RegulonDB 11.0: Gene Sequence
lafU gene sequence


Size: 756        A: 204  T: 153  G: 221  C: 178

Fasta

 

>lafU E. coli K12. Version NC_000913.3 GI:556503834
gtcagtaaatccgagcgtgaaagcattatcgccgcgctgcacgggcagtcgatttttaac
ggtggtgggctgtcgccgttaaataaaatcagcccgtctcatccgccaaaacctgccacc
gtggcggtgccggaagagacggagaaaaaagcgcgtgatgtgaatgagaaaacggcgctg
ctgaagaagaaatccgccaccgagcttggtgagctggcaaccagtatcaacaccattgcc
cgtgatgcgcatatggaagcgaatctggagatggagattgttccccagggattacgcgtg
ctgattaaagacgaccagaaccgcaatatgtttgaacgcggcagcgcgaagattatgccg
ttctttaaaacgctgctggtggagctcgcgccagtgttcgactcgctcgataataaaatt
attattaccgggcataccgatgcgatggcctacaaaaacaatatctacaacaactggaac
ctttcgggtgaccgcgcgctttcggctcgtcgggtgctggaagaggccggaatgccggaa
gataaagtgatgcaggtaagcgcaatggcggaccagatgctgctggattccaaaaatccg
caaagcgcgggcaaccggcgcattgagattatggtgctgaccaaaagtgcgtccgatacg
ctgtatcaatactttggtcagcatggggataaagtggtgcagccgctggtgcaaaagctg
gataagcagcaggtgctttcgcagcgaacgcgttaa
              
                            

Download fasta file
RegulonDB