RegulonDB RegulonDB 10.10: Gene Sequence
yafN gene sequence


Size: 294        A: 95  T: 75  G: 62  C: 62

Fasta

 

>yafN E. coli K12. Version NC_000913.3 GI:556503834
atgcatcgaattctcgctgaaaaatcggtcaatatcactgagttacgtaaaaacccagct
aaatactttattgatcaaccggttgcggttctttctaataatcgccccgcaggatatctc
ttaagtgccagcgcattcgaagcgttaatggacatgcttgctgaacaagaggagaaaaag
cccataaaggcgcgcttccgtccaagtgctgcaagattagaggaaattacacgccgcgct
gaacaatatcttaatgatatgacggatgatgatttcaatgactttaaggaataa
              
                            

Download fasta file
RegulonDB