RegulonDB RegulonDB 10.10: Gene Sequence
yafO gene sequence


Size: 399        A: 114  T: 111  G: 90  C: 84

Fasta

 

>yafO E. coli K12. Version NC_000913.3 GI:556503834
atgcgggtattcaaaacaaaacttattcgcctgcaacttacagcagaggaacttgatgcg
ttaacggcggattttatttcctataagcgtgacggtgttttgccagatatatttggtcgc
gatgcactctacgacgactcctttacctggccattaatcaaatttgagcgagttgctcat
attcatctggcaaatgagaataatccatttccgccacagttgcgccaattcagcagaacg
aatgacgaagcgcatttggtatattgtcagggggcgtttgatgagcaagcatggttgctc
attgccattctgaaacctgaacctcataaactggctcgagataacaaccaaatgcataaa
attgggaaaatggcagaagcgtttcgcatgcgtttttga
              
                            

Download fasta file
RegulonDB