RegulonDB RegulonDB 10.9: Gene Sequence
yafP gene sequence


Size: 453        A: 130  T: 127  G: 98  C: 98

Fasta

 

>yafP E. coli K12. Version NC_000913.3 GI:556503834
atgaataacatacaaataagaaactatcagcctggcgattttcagcaactatgcgctatt
ttcattagagcggttacgatgaccgccagtcagcattattcaccacaacaaatttccgcc
tgggcgcagattgacgaatctcgctggaaggagaaactcgcgaaatcacaagtgtgggtt
gcgatcattaatgcacaaccggttggttttatttcccgcattgaacattatatcgatatg
ttatttgttgaccctgaatacacccgccgtggggttgccagcgctttgttaaaacctttg
attaagtctgaatccgaacttacggtggacgcaagcataaccgcaaaacccttttttgaa
cgttatggttttcagacagttaagcagcagcgcgttgaatgccggggagcgtggtttact
aatttttatatgcgatataaaccgcaacattaa
              
                            

Download fasta file
RegulonDB