RegulonDB RegulonDB 10.9: Gene Sequence
ykfJ gene sequence


Size: 267        A: 64  T: 64  G: 69  C: 70

Fasta

 

>ykfJ E. coli K12. Version NC_000913.3 GI:556503834
atggaatggtacatgggcaaatatattcgtcccttatccgatgcggtatttaccatcgca
tctgatgacctgtggatcgagagtttagcgatccaacaattacacaccacggcaaattta
cccaacatgcagcgcgtagtggggatgccagatttacaccccggacgcggctacccgatt
ggcgcagcgttcttctctgttggtcgtttttacccggcaagacgtcgcggtaacggtgct
ggaaacagaaacgggccgctactctga
              
                            

Download fasta file
RegulonDB