RegulonDB RegulonDB 10.8: Gene Sequence
ykfI gene sequence


Size: 342        A: 90  T: 77  G: 91  C: 84

Fasta

 

>ykfI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaactttacctgcaataactcagcgggcggtgaagccctgcctgtcacccgtggct
gtctggcaaatgttactgacacgtctgctggaacagcactatggtctgacaataaacgac
acgccattctgcaatgaggctgtgattaaggaacacatcgatgccggtatcaccctagcc
gatgccgtgaattttctggtagaaaaatacgagctggttcgtatcgacaggaagggattt
agctggcaggaacaatctccttatctccgggctgcagacattctgcgagcgcggcaggca
actggcttgttgcggcaaagccgtaacaacgtagtacgatga
              
                            

Download fasta file
RegulonDB