RegulonDB RegulonDB 10.8: Gene Sequence
yafW gene sequence


Size: 318        A: 76  T: 61  G: 78  C: 103

Fasta

 

>yafW E. coli K12. Version NC_000913.3 GI:556503834
atgagcaaccctaccaggggcctgcagcgggagattacactgcgcctgggagcccgtctg
gtgcaggaaggcaaccgactgcattatctggctgaccgggccagcatcaccggcaagttc
agtgacatcgaatgccggaagctggatgaaacattcccgcactttatcctccagatggaa
tcgatgctgaccaccggtgaactcagcccccaccatgcccactgcgttaccctgtaccac
aacgatttaacctgcgaagccgacacccttggcagttgcggctacgtatacatcgccatt
taccccactcagcgttaa
              
                            

Download fasta file
RegulonDB