RegulonDB RegulonDB 10.9: Gene Sequence
ykfG gene sequence


Size: 477        A: 98  T: 100  G: 132  C: 147

Fasta

 

>ykfG E. coli K12. Version NC_000913.3 GI:556503834
atgaaacagctttcctttttacccggcgagatgacgccacaggaccggcgtctcattcag
cgggcgctcagggctctggaccgccacctgcatgagcccggcgtagccttcacctctacc
cacgccgtacgtgaatggctgcgactgcatatggccgcgcttgagcgggaagagttccgg
gtgttgtatctggacaaccagaatcagttgattgcccatgaaacgctcttcaccggcacg
attaaccgcaccgaggtgcatccccgggaggtggtcaaacgtgctctgcacttcaacgcg
gcggcggtgatactcgcgcataaccatccttccggcgagacgacacctagccaggccgac
aaaaccctcacgcagcgactggttcaggtgcttcagctggtggatatccgtgtccctgac
catctgattgtcggtggcaggcaaatctattcgttcgcagaacacggtctgctttga
              
                            

Download fasta file
RegulonDB