RegulonDB RegulonDB 10.9: Gene Sequence
ykfF gene sequence


Size: 240        A: 54  T: 45  G: 67  C: 74

Fasta

 

>ykfF E. coli K12. Version NC_000913.3 GI:556503834
atgacccaatccgtgttgctgccaccggggcctttcacccggagacaagcgcaagcggtc
actaccacgtacagcaatatcacactcgaagacgaccagggcagtcacttccgtctggtg
gttcgtgatactgaaggccggatggtctggcgggcatggaactttgagccggatgccggt
gaaggtcttaaccgctatatccgcacctcaggcatccgtacagacacggccacccgctga
              
                            

Download fasta file
RegulonDB