RegulonDB RegulonDB 10.9: Gene Sequence
yafZ gene sequence


Size: 822        A: 176  T: 171  G: 252  C: 223

Fasta

 

>yafZ E. coli K12. Version NC_000913.3 GI:556503834
atgacccgtctggcttcgcgctttggcgcagcaaaccttatccgtcgcgaccgtccgtta
acccgtgaagagctgtttcgcgtagtgcccagtgtattcagtgaggacaaacacgagtcc
cgtagtgagcgttatacctatatacccaccatctccctgctcgacagcctacagcgagaa
ggcttccagccattctttgcctgtcagacccgcgtgcgtgacccgggtcgtcgtgaacat
acaaagcatatgctgcgtctgcggcgggaagggcagatcaccggtaaacaggtgccggaa
attattctactcaactctcacgatggaaccagttcgtatcagatgttgccgggactattt
cgtgcggtttgtcagaacgggctcgtctgcggtgagtcgtttggcgaggtgcgggtgcca
cacaagggggacgtggtgagtcaggtgattgaaggcgcgtatgaggtgctggggattttt
gaccgggtggaggagaaacgggatgccatgcagtcgttgctgttgccacccccggcacag
caggcactggcaaaagccgccctcacataccgctttggtgaagaccaccagccggtgact
gaatcgcagatcctctcccctcgccgctggcaggatgagagcaatgacctgtggaccacg
taccagcgtattcaggagaacctgattaagggcgggctcagtggccgtaatgccaaagga
ggacggtcacatacccgtgccgttcgcggtatcgacggggacgtgaaacttaaccgggca
ctgtgggtgatggcggaagccctgctcacgcaactgcagtga
              
                            

Download fasta file
RegulonDB