RegulonDB RegulonDB 10.9: Gene Sequence
ykfA gene sequence


Size: 864        A: 171  T: 202  G: 262  C: 229

Fasta

 

>ykfA E. coli K12. Version NC_000913.3 GI:556503834
atgaataattctgaaggtttgaagtcgtttcagcaatcgcttgctgatctgccgcaatgg
gtatcagagcggcttctgcagcaaattaaccagttaactaactacgagccagtgatcggc
attatgggtaaaaccggtgttgggaagagcagtctgtgcaatgccctgtttgccggagat
atatcaccggtcagcgatgtggcggcctgtacacgtgagccactgcgctttcgcctgcaa
gtcggcgaccgctatataacgctgatggatctgcccggcgtgggcgaaagtggcgctcgc
gataccgagtatgctgcgctgtaccgcgaacagcttcctcgcctcgacctggtactgtgg
ctgattaaggccgatgaccgggcgctgacggtggatgaacatttttatcatcaggtgatt
ggagaggtataccggcataaggtgctgtttgttatcagccagtcggataaggccgaacct
accagcggtgggggacagttgtccacggcgcagaagcagaatatcagccgcaaaatctgc
ctgctgcatgagctgttccagcccgtccatccggtgtgtgctgtgtcggtccgtctacaa
tgggggcttaaggtgatggccgagcggatgattaagtgcctgccacgtgaggccaccagc
ccggtggtgtcgcaactccatccttcctttcgcacgacggtagtccgggaacaggctcgt
agcgattttggtgaaaccgtcggggccgtactcgatagcatcagtgcctttcccctgata
cccgccccggtgcgggccgtcattcaggccgtgcgcaccacggtggtgtcagtggcccgc
gccgtctgggatttcttcttctga
              
                            

Download fasta file
RegulonDB