RegulonDB RegulonDB 10.9: Gene Sequence
perR gene sequence


Size: 894        A: 230  T: 235  G: 216  C: 213

Fasta

 

>perR E. coli K12. Version NC_000913.3 GI:556503834
atgaagctcttagcaaaagcacctctaaatctgttacgcgcctttgaagcggctggtcgt
accggagcttttgcgttggccgcctctgagttggaactgtcacccagtgcgatcagccat
gccatccgcaaactggaaaacttgcttgatgtacgcctttttcagcgcagtacgcgagaa
attacgctgacgaaagaaggtgaaatactgcttgagcacatacagcggggatttaacgaa
ttacagcaggggttggcattagtgacggctgatgaatccaggcctttgcgccttcatact
gcaccgagttttgcccatcaatggcttttaccacgtcttggtaagttcatacgtgagaac
ccaagcatcgatctgcgactttcagccagcacagaatatgcacgttttgaacaggatgat
tttgatctcgatatagtctacggtgaaccccgcccatcaccctatgagaagatcccgctt
gctgttgaagaacttacgccactgtgttctccccaactggctgagcggctaaagaaacca
gaggatctctatgcgttgacattgattcagtgcgatgtgcagttgtaccagtggaaagga
tggtttgaggcgaataagatgacgccacccaataattatggccttcgatttgaccgtagc
tttatggcgattgctgccgcagttgacggcttgggagttgtgcttgaatcaaaactactg
gctgaacgtgaaatcgctagcggtaaactggtatgcccacttgtaaacagtaccagcgaa
atacattacatcggtcattatttggttttcccccagcaccaacacatgcattctgcgctt
gatgtgttcaaaacctggctactgaatgaactcaatctgggtaaaattcgttga
              
                            

Download fasta file
RegulonDB