RegulonDB RegulonDB 10.9: Gene Sequence
insI1 gene sequence


Size: 1152        A: 372  T: 252  G: 271  C: 257

Fasta

 

>insI-1 E. coli K12. Version NC_000913.3 GI:556503834
atgagacgaacatttacagcagaggaaaaagcctctgtttttgaactatggaagaacgga
acaggcttcagtgaaatagcgaatatcctgggttcaaaacccggaacgatcttcactatg
ttaagggatactggcggcataaaaccccatgagcgtaagcgggctgtagctcacctgaca
ctgtctgagcgcgaggagatacgagctggtttgtcagccaaaatgagcattcgtgcgata
gctactgcgctgaatcgcagtccttcgacgatctcacgtgaagttcagcgtaatcggggc
agacgctattacaaagctgttgatgctaataaccgagccaacagaatggcgaaaaggcca
aaaccgtgcttactggatcaaaatttaccattgcgaaagcttgttctggaaaagctggag
atgaaatggtctccagagcaaatatcaggatggttaaggcgaacaaaaccacgtcaaaaa
acgctgcgaatatcacctgagacaatttataaaacgctgtactttcgtagccgtgaagcg
ctacaccacctgaatatacagcatctgcgacggtcgcatagccttcgccatggcaggcgt
catacccgcaaaggcgaaagaggtacgattaacatagtgaacggaacaccaattcacgaa
cgttcccgaaatatcgataacagacgctctctggggcattgggagggcgatttagtctca
ggtacaaaaaactctcatatagccacacttgtagaccgaaaatcacgttatacgatcatc
gttagactcaggggcaaagattctgtctcagtaaatcaggctcttaccgacaaattcctg
agtttaccgtcagaactcagaaaatcactgacatgggacagaggaatggaactggccaga
catctagaatttactgtcagcaccggcgttaaagtttacttctgcgatcctcagagtcct
tggcagcggggaacaaatgagaatacaaatgggctaattcggcagtactttcctaaaaag
acatgtcttgcccaatatactcaacatgaactagatctggttgctgctcagctaaacaac
agaccgagaaagacactgaagttcaaaacaccgaaagagataattgaaaggggtgttgca
ttgacagattga
              
                            

Download fasta file
RegulonDB