RegulonDB RegulonDB 10.9: Gene Sequence
ykfC gene sequence


Size: 1146        A: 285  T: 236  G: 329  C: 296

Fasta

 

>ykfC E. coli K12. Version NC_000913.3 GI:556503834
ttgataatcagcgaaatgcaacgcaagcttgccacatgggcagccaccgatccgtcccta
cggattcaacggctgctgcgtctgataacacaaccagaatggctggctgaagcggcgcgg
atcacgctttcatcaaagggggcccatacccccggcgttgatggcgtgaacaaaacaatg
ctacaggccagactggctgttgagctgcaaatcctcagggatgaattactctcaggccac
taccagcccttgcccgccagacgggtttacatccctaaaagcaacggcaaactgcgacca
ctgggtatccccgcgttgcgggatcgtattgttcagcgggccatgctgatggcgatggag
ccgatatgggagagtgattttcatacgctctcatatggcttccggcctgagcgcagtgtc
caccacgcgatccgcacggtgaaattacagctcacagactgtggtgaaacccggggacgc
tgggtgattgaaggcgacctgtccagttacttcgacaccgtacatcatcgactgctgatg
aaggctgtacgccgcaggatcagtgacgcacgtttcatgactctgctgtggaaaaccatc
aaggcgggacatatcgatgtcggtctctttcgggcggccagtgaaggtgtgccacagggc
ggtgttatatcgccgctattatcgaacatcatgctgaatgagttcgatcaatacctgcat
gagcgctacctgagcgggaaagccagaaaagatcggtggtactggaataacagtatccaa
cggggccgaagtacggcggtcagagaaaactggcagtggaaacccgcggtggcgtactgc
cgctatgccgatgattttgtcctcatcgtcaaaggcaccaaagcacaggtggaagccatc
agggaggagtgtcggggtgtgctcgaaggcagtctgaaactcaggctgaacatggataag
actaaaatcccccatgttaatgacggctttatctttctggggcacaggctcattcgcaaa
cgcagtcgttatggcgagatgcgagtggtctcaacgatcccgcaggagaaagccagaaac
ttcgccgcatcgctgacagcactgttatggaaggtgcgaataagcggggaaattcttctc
ggctga
              
                            

Download fasta file
RegulonDB