RegulonDB RegulonDB 10.9: Gene Sequence
insH1 gene sequence


Size: 981        A: 258  T: 183  G: 263  C: 277

Fasta

 

>insH-1 E. coli K12. Version NC_000913.3 GI:556503834
atgtttgtcatctggagccatagaacagggttcatcatgagtcatcaacttaccttcgcc
gacagtgaattcagcagtaagcgccgtcagaccagaaaagagattttcttgtcccgcatg
gagcagattctgccatggcaaaacatggtggaagtcatcgagccgttttaccccaaggct
ggtaatggccggcgaccttatccgctggaaaccatgctacgcattcactgcatgcagcat
tggtacaacctgagcgatggcgcgatggaagatgctctgtacgaaatcgcctccatgcgt
ctgtttgcccggttatccctggatagcgccttgccggaccgcaccaccatcatgaatttc
cgccacctgctggagcagcatcaactggcccgccaattgttcaagaccatcaatcgctgg
ctggccgaagcaggcgtcatgatgactcaaggcaccttggtcgatgccaccatcattgag
gcacccagctcgaccaagaacaaagagcagcaacgcgatccggagatgcatcagaccaag
aaaggcaatcagtggcactttggcatgaaggcccacattggtgtcgatgccaagagtggc
ctgacccacagcctggtcaccaccgcggccaacgagcatgacctcaatcagctgggtaat
ctgctgcatggagaggagcaatttgtctcagccgatgccggctaccaaggggcgccacag
cgcgaggagctggccgaggtggatgtggactggctgatcgccgagcgccccggcaaggta
agaaccttgaaacagcatccacgcaagaacaaaacggccatcaacatcgaatacatgaaa
gccagcatccgggccagggtggagcacccatttcgcatcatcaagcgacagttcggcttc
gtgaaagccagatacaaggggttgctgaaaaacgataaccaactggcgatgttattcacg
ctggccaacctgtttcgggcggaccaaatgatacgtcagtgggagagatctcactaa
              
                            

Download fasta file
RegulonDB