RegulonDB RegulonDB 10.9: Gene Sequence
mmuP gene sequence


Size: 1404        A: 241  T: 393  G: 428  C: 342

Fasta

 

>mmuP E. coli K12. Version NC_000913.3 GI:556503834
atgcaaacaacacaacaaaatgcgccactgaagcgcacaatgaaaacgcgtcacctgatt
atgctttccttgggcggcgtgattggcacaggattattcttcaataccgggtacatcatt
tccaccactggagcggcgggaacgctgctggcctatctgattggtgcgctggtggtctgg
ctggttatgcagtgtctgggcgagctgtcggtcgcgatgccggagaccggagcgtttcac
gtttatgccgcgcgctatcttggtccggctaccgggtataccgtggcctggctttactgg
ctgacctggaccgtggcgctgggttcgagctttaccgccgctggattctgtatgcagtac
tggtttccacaggtgccggtatgggtctggtgcgtggtgttctgcgcgattatttttggt
ctgaatgttatctccacgcgcttttttgccgaaggggagttctggttctcgctggtcaaa
gtggtcactatcatcgcctttatcatcctcggtggggcggcgattttcggctttattccg
atgcaggatggctcgcccgcgccggggctgagtaatatcacggcagaaggctggttcccg
cacggtggcttaccgattttgatgactatggtggcagtgaactttgctttttcgggtacc
gagcttatcggcattgccgccggtgaaacggaaaacccgcgcaaagttatcccggtagcg
attcgtactaccatcgcgcgactgattattttctttatcggcaccgtgtttgtgctggca
gcgctgatcccgatgcagcaggtgggcgtggagaaaagcccgtttgtgctggtatttgag
aaagtagggatcccgtacgccgctgatatttttaacttcgtgatcctgacggctattctt
tctgcagcgaactccgggttatatgcctccgggcgcatgctgtggtcgttgtcgaatgaa
cgtacgctaccggcctgttttgcgcgagtaacgaaaaacggcgtgccactgacggcgctg
tcggtcagtatgctcggtggtgtgctggcgctgttttccagcgtggtggccccggacacg
gtatttgttgcgctgtcggcaatctccgggtttgcggtggtagcggtgtggctgagtatc
tgcgcctcgcattttgtttttcgtcgccgtcatctgcaacaaggtaaggcattgagtgaa
ttacattatcgcgcgccgtggtatccgctggtgccagtattaggttttgtgctgtgcctg
gtggcctgtgttgggctggcattcgatccagcgcagagaattgcgttgtggtgcgggtta
ccgtttgttgcgttgtgctatggtgcttatttccttactcaaccccgaaacgcaaaacag
gagccagaacatgtcgcagaataa
              
                            

Download fasta file
RegulonDB