RegulonDB RegulonDB 10.9: Gene Sequence
mmuM gene sequence


Size: 933        A: 175  T: 195  G: 315  C: 248

Fasta

 

>mmuM E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcagaataatccgttacgcgctcttcttgataaacaggatatcctgctgctggat
ggcgcgatggcgacggagctggaagcgcgagggtgtaacttagccgacagcctgtggtca
gccaaagtgctggtagaaaacccggagcttatccgcgaagtgcatcttgattactaccgg
gcgggggcgcaatgcgcgatcactgccagctatcaggcgacgccggcgggcttcgccgcg
cgaggtctggatgaagcgcagtcgaaagcgctgattggcaaaagcgtggagctggcgcgt
aaagcccgtgaagcgtatctggcagagaacccgcaggcgggaacgcttctggtggcggga
tccgtcgggccttacggcgcgtatctggcggatggctctgaataccgtggcgattatcat
tgtagcgttgaggcatttcaggcgtttcatcgcccgcgcgtggaagccttgctggatgcc
ggggccgatctgctggcctgcgaaaccctgccgaatttttccgagattgaggcgttggcc
gagctgttgaccgcatatccgcgtgcgcgggcgtggttctcatttaccctgcgcgacagc
gaacacctgagcgacggtacgccgctgcgtgacgtggttgcgttgctggcgggttatccg
caggtggtggcgctaggcattaactgtattgcgctggaaaacaccaccgctgcgttgcag
catttacacggtttaacggtgctgccgctggtggtgtatccgaactcgggcgagcattac
gatgccgtgagcaaaacctggcatcatcacggtgaacattgcgcgcagctggcggattat
ctgccgcagtggcaggccgctggcgcacggttgattggcgggtgctgtcgcaccacgcct
gcggatatcgccgcgttaaaagcgcgaagctga
              
                            

Download fasta file
RegulonDB