RegulonDB RegulonDB 10.9: Gene Sequence
insA2 gene sequence


Size: 276        A: 63  T: 66  G: 66  C: 81

Fasta

 

>insA-2 E. coli K12. Version NC_000913.3 GI:556503834
gtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaac
ggcaaaagcactgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaa
ctgcagttcacttacaccgcttctcaacccggtacgcaccagaaaatcattgatatggcc
atgaatggcgttggatgccgggcaaccgcccgcattatgggcgttggcctcaacacgatt
ttccgccatttaaaaaactcaggccgcagtcggtaa
              
                            

Download fasta file
RegulonDB