RegulonDB RegulonDB 10.8: Gene Sequence
yagE gene sequence


Size: 909        A: 175  T: 174  G: 264  C: 296

Fasta

 

>yagE E. coli K12. Version NC_000913.3 GI:556503834
atgccgcagtccgcgttgttcacgggaatcattccccctgtctccaccatttttaccgcc
gacggccagctcgataagccgggcaccgccgcgctgatcgacgatctgatcaaagcaggc
gttgacggcctgttcttcctgggcagcggtggcgagttctcccagctcggcgccgaagag
cgtaaagccattgcccgctttgctatcgatcatgtcgatcgtcgcgtgccggtgctgatc
ggcaccggcggcaccaacgcccgggaaaccatcgaactcagccagcacgcgcagcaggcg
ggcgcggacggcatcgtggtgatcaacccctactactggaaagtgtcggaagcgaacctg
atccgctatttcgagcaggtggccgacagcgtcacgctgccggtgatgctctataacttc
ccggcgctgaccgggcaggatctgactccggcgctggtgaaaaccctcgccgactcgcgc
agcaatattatcggcatcaaagacaccatcgactccgtcgcccacctgcgcagcatgatc
cataccgtcaaaggtgcccatccgcacttcaccgtgctctgcggctacgacgatcatctg
ttcaataccctgctgctcggcggcgacggggcgatatcggcgagcggcaactttgccccg
caggtgtcggtgaatcttctgaaagcctggcgcgacggggacgtggcgaaagcggccggg
tatcatcagaccttgctgcaaattccgcagatgtatcagctggatacgccgtttgtgaac
gtgattaaagaggcgatcgtgctctgcggtcgtcctgtctccacgcacgtgctgccgccc
gcctcgccgctggacgagccgcgcaaggcgcagctgaaaaccctgctgcaacagctcaag
ctttgctga
              
                            

Download fasta file
RegulonDB