RegulonDB RegulonDB 10.9: Gene Sequence
yagF gene sequence


Size: 1968        A: 347  T: 308  G: 685  C: 628

Fasta

 

>yagF E. coli K12. Version NC_000913.3 GI:556503834
atgaccattgagaaaattttcaccccgcaggacgacgcgttttatgcggtgatcacccac
gcggcggggccgcagggcgctctgccgctgaccccgcagatgctgatggaatctcccagc
ggcaacctgttcggcatgacgcagaacgccgggatgggctgggacgccaacaagctcacc
ggcaaagaggtgctgattatcggcactcagggcggcatccgcgccggagacggacgccca
atcgcgctgggctaccacaccgggcattgggagatcggcatgcagatgcaggcggcggcg
aaggagatcacccgcaatggcgggatcccgttcgcggccttcgtcagcgatccgtgcgac
gggcgctcgcagggcacgcacggtatgttcgattccctgccgtaccgcaacgacgcggcg
atcgtgtttcgccgcctgatccgctccctgccgacgcggcgggcggtgatcggcgtagcg
acctgcgataaagggctgcccgccaccatgattgcgctggccgcgatgcacgacctgccg
actattctggtgccgggcggggcgacgctgccgccgaccgtcggggaagacgcgggcaag
gtgcagaccatcggcgcgcgtttcgccaaccacgaactctccctgcaggaggccgccgaa
ctgggctgtcgcgcctgcgcctcgccgggcggcgggtgtcagttcctcggcacggcgggc
acctcgcaggtggtcgcggaggcgctgggtctggcgctgccgcactccgcgctggcgccg
tccgggcaggcggtgtggctggagatcgcccgccagtcggcgcgcgcggtcagcgagctg
gatagccgcggcatcaccacgcgggatatcctctccgataaagccatcgaaaacgcgatg
gtgatccacgcggcgttcggcggctccaccaatttactgctgcacattccggccatcgcc
cacgcggcgggctgcacgatcccggacgttgagcactggacgcgcatcaaccgtaaagtg
ccgcgtctggtgagcgtgctgcccaacggcccggactatcacccgaccgtgcgcgccttc
ctcgcgggcggcgtgccggaggtgatgctccacctgcgcgacctcggcctgctgcatctg
gacgccatgaccgtgaccggccagacggtgggcgagaaccttgaatggtggcaggcgtcc
gagcgccgggcgcgcttccgccagtgcctgcgcgagcaggacggcgtagagccggatgac
gtgatcctgccgccggagaaggcaaaagcgaaagggctgacctcgacggtctgcttcccg
acgggcaacatcgctccggaaggttcggtgatcaaggccacggcgatcgacccgtcggtg
gtgggcgaagatggcgtataccaccacaccggccgggtgcgggtgtttgtctcggaagcg
caggcgatcaaggcgatcaagcgggaagagattgtgcagggcgatatcatggtggtgatc
ggcggcgggccgtccggcaccggcatggaagagacctaccagctcacctccgcgctaaag
catatctcgtggggcaagacggtgtcgctcatcaccgatgcgcgcttctcgggcgtgtcg
acgggcgcctgcttcggccacgtgtcgccggaggcgctggcgggcgggccgattggcaag
ctgcgcgataacgacatcatcgagattgccgtggatcgtctgacgttaactggcagcgtg
aacttcatcggcaccgcggacaacccgctgacgccggaagagggcgcgcgcgagctggcg
cggcggcagacgcacccggacctgcacgcccacgactttttgccggacgacacccggctg
tgggcggcactgcagtcggtgagcggcggcacctggaaaggctgtatttatgacaccgat
aaaattatcgaggtaattaacgccggtaaaaaagcgctcggaatttaa
              
                            

Download fasta file
RegulonDB