RegulonDB RegulonDB 10.9: Gene Sequence
yagG gene sequence


Size: 1383        A: 217  T: 302  G: 416  C: 448

Fasta

 

>yagG E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaattaaccatgaaagacaaaattggctacgggctgggagacaccgcctgcggc
ttcgtctggcaggccacgatgttcctgctggcctatttctacaccgacgtcttcggcctg
tcggcggggattatgggcacgctgtttttggtctcccgcgtgctcgacgccgtcaccgac
ccgctgatggggctgctggtagaccgcacccgcacgcggcacggccagttccgcccgttc
ctgctgtggggggccatcccgttcggcatcgtctgcgtgctgaccttctacacgccggac
ttctccgcacagggcaagatcatctacgcctgcgtgacctacattctcctgaccctggtc
tacaccttcgttaacgtgccgtactgcgccatgccgggcgtcatcaccgccgacccgaaa
gagcgtcacgccctgcagtcctggcgcttcttcctggcggcggcgggctcgctcgctatc
agcggcatcgcgctgccgctggtgagcatcatcggcaaaggggacgagcaggtgggctac
ttcggcgccatgtgcgtgctggggctgagcggcgtggtgctgctctacgtctgcttcttc
acgaccaaagagcgctacacctttgaggtgcagccgggctcgtcggtggcgaaagacctt
aagctgctgctgggcaacagccagtggcgcatcatgtgcgcgttcaagatgatggcgacc
tgctccaacgtggtgcgcggcggggcgacgctctacttcgtgaaatacgtgatggatcac
ccggagttggcgacccagtttttactttacggcagcctcgccaccatgttcggctcgctt
tgctcctcacgcctgctgggccgcttcgaccgcgtcaccgccttcaagtggatcatcgtc
gcctactcgctgatcagcctgctgattttcgtcaccccggcggagcacatcgcgctcatt
tttgccctcaacatcctgttcctgttcgtctttaataccaccacgccgctgcagtggctg
atggcttctgacgtggtggactacgaggagagccgcagcggtcgccgcctcgacgggctg
gtgttctccacctacctgttcagcctgaagattggcctggcgattggcggggcggtggtg
ggctggatcctggcgtacgtcaactattccgccagcagcagcgtgcagccggttgaggtg
ctcaccaccatcaaaattctgttctgcgtggtgccggtggtgctctacgcgggcatgttc
atcatgctgtcgctctacaagctcaccgatgcccgcgtggaggccatcagccggcagctg
attaagcaccgcgcggcgcagggcgaggccgttcccgacgccgcgacagccgcatcccat
taa
              
                            

Download fasta file
RegulonDB