RegulonDB RegulonDB 11.0: Gene Sequence
yagH gene sequence


Size: 1611        A: 306  T: 268  G: 492  C: 545

Fasta

 

>yagH E. coli K12. Version NC_000913.3 GI:556503834
atggaaatcactaacccgatactcaccggcttcaacccggacccgtccctgtgccgccag
ggcgaggactactacatcgccacctcgaccttcgagtggttcccgggcgtgcgcatctac
cactcccgtgacctgaaaaactggtcgctggtcagcaccccgttggaccgcgtgtcgatg
ctggacatgaagggcaacccggactccggcggcatctgggcgccgtgcctgagctacgcc
gacggtaaattctggctgctctacaccgacgtgaagattgtcgactcgccgtggaaaaac
ggccgcaacttcctcgtcaccgcgccctccatcgaggggccatggagcgagccaatcccg
atgggcaacggcgggtttgacccgtccctgttccacgacgacgatggccgcaaatactat
atctaccgcccgtgggggccgcgccaccacagcaacccgcacaacaccatcgtgttacag
gcgtttgacccgcagaccggcacgctctcgcccgagcgcaaaacgctgtttaccggcacg
ccgctctgctacaccgaaggcgcgcacctgtatcgccacgcgggatggtactacctgatg
gccgccgagggcggcaccagctacgagcacgccgtcgtggtgctgcgttccaaaaatatc
gacgggccgtacgagctgcacccggacgtaacgatgatgaccagctggcacctgccggag
aacccgctgcagaagagcggccacggctcgctgctgcagacgcatacgggtgaatggtac
atggcctacctcaccagccgcccgctgcgcctgcccggcgtgccgctgctggcctccggc
ggacgcggctactgcccgctggggcgcgagaccggcatcgcccgcattgaatggcgcgac
ggctggccgtacgtggaaggcggcaagcacgcgcagctgaccgtgaaaggcccgcaagta
gccgagcagcctgcagccgttccgggcaactggcgggacgatttcgacgccagttcgctt
gacccggagctgcagaccctgcgcattccgttcgacgacaccctcggctcgctcaccgcg
cgcccgggcttcttacggctctatggcaacgactcgctcaattcgaccttcacccaatcg
accgtggcgcgccgctggcagcacttcgccttccgggcagaaacgcggatggagttctcg
ccggtgcacttccagcagagcgcggggctgacctgctactacaacagcaaaaactggagc
tactgctttgtggactacgaggagggacagggtagaaccatcaaagttatccagctcgac
cacaacgtgccgtcgtggccgctgcacgagcagcccattccggtgccggaacatgcggag
agcgtctggctgcgggtggacgtggatacgctggtctaccgctacagctactcgtttgat
ggcgagacgtggcacaccgtgccggtgacgtatgaggcgtggaagctgtcggacgactac
atcggcgggcgcggcttcttcaccggcgcgtttgtgggcctgcactgcgaggacatcagc
ggcgacggctgctacgcggacttcgactacttcacctacgagccggtctaa
              
                            

Download fasta file
RegulonDB