RegulonDB RegulonDB 10.9: Gene Sequence
xynR gene sequence


Size: 759        A: 148  T: 131  G: 238  C: 242

Fasta

 

>xynR E. coli K12. Version NC_000913.3 GI:556503834
atgccgattattcagtctgttgaacgtgcgttgcagatcctcgacctgttcaacgagcag
gccaccgagcttaagatcaccgacatcagcaaactgatggggctgagcaagagtaccctc
cactcgctgctaaaaaccctgcagcttcacggctatatcgatcagaacccggagaacggc
aagtatcgcctcggcatgaagctggtcgagcgcggccattttgtcgtgggctccatcgat
attcggcagaaggcaaaaggctggctgacggagctgtcccggcggaccgggcagaccacc
catctggggatcctggacgggcgtgaaggggtctatatcgagaagattgaaggcaagctg
gccgccatcgcctattcacgcatcggccgccgcctgccggtgcacgccaccgccatcggc
aaggtgttgattgcctggctgggcgaggccgagctgaacgccctgctggagggctatcag
tacactacctttacgcccgccaccctcgcgtctcgcgaagccttaatgagcgccctggcg
cagacccgcgagcaaggctacgccctggacagcgaagagaacgagcagggcgtgcgctgc
gtggcggtgccggtgtggaaccacgagtcccgcgtcatcgccgccctgagcctgtcgacg
ctgacctcccgcgtggacgacgcggagctggctaatttccgcgagcagcttcagcaggcc
gggctcgcgctctcgcgcgcgctgggctacccggcctga
              
                            

Download fasta file
RegulonDB